mRNA Vaccines Actually are “Gene Therapy”, Study Shows
A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.
What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.
It was Not Supposed to Happen
For over a year, our trusted “health experts and fact checkers” kept telling us the opposite:
However, the bombshell article from Current Issues of Molecular Biology shows the opposite.
Details
What the article shows is that in vitro, using a human liver cell line, Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme called LINE-1, and the genetic code of the vaccine is reverse transcribed into the DNA.
It also explains that vaccine mRNA actually does travel to the liver as one of the preferred sites (the other sites, as we heard, are ovaries and more).
What does it mean? Normally, our cells do the opposite: the cell nucleus, where the DNA is, expresses certain DNA code based on conditions of the cell, and produces natural, human messenger RNA. That messenger RNA travels out of the nucleus, where it is expressed into proteins needed for cell building. This is how growing organisms express different genetic programs to grow muscle cells or brain cells, etc.
This process is called “transcription”.
For many years, Central Dogma of Molecular Biology stated that the “reverse transcription” — moving genetic code from RNA back into the sacred cellular nucleus and recoding the DNA — was impossible. Eventually, scientists realized that it is possible under various conditions. For example, the HIV RNA virus is able to do so and it reprograms our DNA to produce copies of it. HIV is the virus that causes AIDS.
To effect reverse transcription, enzymes called “reverse transcriptases” are needed. One of them is called LINE-1.
Apparently, per study, the Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme.
After seeing LINE-1 reverse transcriptase rise, they tested for alterations to the DNA, making sure they are not picking up the RNA instead.
The genetic code that they picked up is:
CGAGGTGGCCAAGAATCTGAACGAGA
GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA
TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT
GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT
TCGACGAGGACGATTCTGAGCCCGTGCTGA
AGGGCGTGAAACTGCACTACACATGATGAC
TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA
GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT
CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA
Anyone wants to run BLAST on it?
Simplified
As I explained in response to a questioner:
Pfizer mRNA vaccine changes our genetic code that determines how our organisms operate, that you inherited from your mom and dad. Now your DNA was changed from what your mom and dad gave you, by adding a little mysterious “edit” from Pfizer.
Your organism acts in accordance with your DNA program, and now, well, the program has been hacked and modified by Pfizer.
This is how Bill Gate’s plan for “transhumanism” and genetically induced depopulation begins. Each day, new revelations are revealed about what has been engineered into this adjuvant to the covid bio weapon. Who knows what new goodies will be discovered with more research into Fuaxci’s monster? What is certain is more and more people will succumb to myocarditis, cancer, infection, and a host of other conditions and diseases yet to be recognized or described.
I am getting the feeling that this may be or is very close to being the perfect mass-genocide in recorded human history. If we get sick and die from a disease such as cancer, aids, flu, or any of the other human ailments that plague us, then it can be said, they died of natural causes. When in fact this situation or pandemic was engineered by a bunch of sociopaths & psychopaths to be a genocidal weapon. I guess time will tell. The question remains, what will sheeple do about it when/if they wake up to the fact they are being murdered? If we had a functional belief in God and a functional legal system/governance, we would be having trials and executions.
What will they do about it? … Nothing. Read the Spartacus Returns post. Once the “heat” is turned on they will all be zombified. Or something like that… 🤡🌎
As a Nation that has provided the environment for – condoned – the killing of more than 63,000,000 unborn children … do you really expect anything different?
Read the Book. A lot of people don’t make it. Sad but true… This is shaping up to look really, really bad for the world. There is still time. To the saved man, Paul writes…
Ephesians 2:1-7 KJB… “And you hath he quickened, who were dead in trespasses and sins; Wherein in time past ye walked according to the course of this world, according to the prince of the power of the air, the spirit that now worketh in the children of disobedience: Among whom also we all had our conversation in times past in the lusts of our flesh, fulfilling the desires of the flesh and of the mind; and were by nature the children of wrath, even as others. But God, who is rich in mercy, for his great love wherewith he loved us, Even when we were dead in sins, hath quickened us together with Christ, (by grace ye are saved;) And hath raised us up together, and made us sit together in heavenly places in Christ Jesus: That in the ages to come he might shew the exceeding riches of his grace in his kindness toward us through Christ Jesus.“
Methinks the “ages to come” are about to materialize. Glorification for the saved, wrath for the rest.
GCP … Think there will be golf in heaven ?
With bodies made like unto His glorified body, I honestly don’t think we’ll care! I’m just lookin’ forward to being in that state where my standing is made physical!
I pray that there’ll be glorified animals with me… 😊 Death is not their fault.
I want a pet lion.
In my heaven there is, and you never get stuck playing with a liberal because you know where they are at.
Yeah, but we’re gonna have to suffer the Great Trib first.
I was hoping to avoid that.
Why do you think that? It’s supposed to be avoided! It can be avoided. You can go through it if you want to, but life will be exceptionally difficult and you very likely will not make it.
Religious and social indoctrination and a functioning legal system (it functions, just not like you were told) are exactly why there aren’t executions.
Capital punishment in certain situations is commanded in Scripture. For some there may be a religious reason, but it’s not a Bible reason.
Do you get the feeling this is a game of who blinks first? Be ready in mind, body and equipment.
What the vaccinated are unaware of is that they have been programmed into hating the unvaccinated.
The reason they will continue to take the jab has nothing to do with their personal health.
For them not to be considered vaccinated means they would become the people they hate.
This ain’t over by a long shot.
Folks, I’ve said it before, time and again…..
The “Vaccine” is the Virus.
Always has been….Always will be.
Prepare and conduct yourself accordingly.
Good Luck, y’all.
Damn, even with 2 co-morbidities I’m tickled pink that I was a vax hold-out, even under verbal assault, harassment and threats by the Nazi left for the last couple years. I’m going to send a copy of this medical study to all the fvcks who banned me from their premises for not taking the jab with the handwritten notion “No antidote for the mRNA jab exists. It’s permanent. Good luck, MF”.
Nobody could’ve known …. reeeeeeeeeeeeee
?width=780&height=520&rect=6153×4102&offset=0x0
In an article of November 25, 2020, by Johns Hopkins, Johns Hopkins admitted to having the capability to ‘vaccinate’ via the test swabs …
https://hub.jhu.edu/2020/11/25/theragripper-gi-tract-medicine-delivery/
Great find. Thanks.
Every day the number of ambulances I hear grows. Down right unsettling.
Noticing the same thing.
Have a friend who knows an EMT. Cardiac issues have definitely increased per the EMT.
Well that proves once and for all the only way to get any truth about any aspect of the whole Convid is to watch the “news” very closely.
Then whatever they say actually means the complete and absolute opposite of whatever your ears heard
It seems some are forgetting this with the new Ukrainian virus.
Apparently, life insurance companies are reporting significant increases in all-cause mortality. The CEO of AmericaOne, a group insurer in Illinois, reported a 40% increase in the last quarter. He said it was common across the industry.
Two things come to mind; how are they gonna keep it under wraps, and at what point will the life insurance companies need to be bailed out (try to cover that up)?
…And there ain’t no detoxing from that.